Volume 9, Issue 3 (10-2021)
Jorjani Biomed J 2021, 9(3): 24-32 |
Back to browse issues page
Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:
nameni F, Falahi S. Simultaneous Effect of Interval Training and Octopamine Extract on NLRP-1 and NLRP-3 In Brain Tissue of Alzheimer's Rats. Jorjani Biomed J 2021; 9 (3) :24-32
URL: http://goums.ac.ir/jorjanijournal/article-1-835-en.html
URL: http://goums.ac.ir/jorjanijournal/article-1-835-en.html
1- Department of Sports Physiology, Varamin Pishva Branch, Islamic Azad University, Varamin, IRAN , nameni@iauvaramin.ac.ir
2- MSc. of Sports Physiology, Varamin Pishva Branch, Islamic Azad University, Varamin, IRAN
2- MSc. of Sports Physiology, Varamin Pishva Branch, Islamic Azad University, Varamin, IRAN
Full-Text [PDF 516 kb]
(1080 Downloads)
| Abstract (HTML) (4565 Views)
.png)
.png)
Full-Text: (799 Views)
Highlights
Synergistic effects of exercise and supplementation reduce the levels of inflamasomes complex index indices and can have a regulatory effect on improving cognitive and cognitive function and delaying dementia-related disorders.
Alzheimer's disease is the most common cause of dementia in the elderly and is characterized by atrophy of certain areas of the brain, reduced progressive perception, and loss of memory, and inability to perform daily tasks. The innate immune response plays an important role in post-Alzheimer's pathology. Inflammation systems are a key component of the innate immune response. Inflammasomes are a set of several proteins based on: NLPR-3 and NLRP-1 (NOD-, LRR- and pyrin domain-containing protein 3), responsible for activating caspase-1, injury, and autoimmune diseases (1). Studies show that NLRP-3 and NLRP-1 may play important roles in metabolic disorders, inflammatory responses, Alzheimer's, and ischemia (2). Physical activity can affect dementia and the perception and development of Alzheimer's disease (3) and mediate its anti-inflammatory effects by regulating the activity of inflammation. Mardar et al. (2016) showed that endurance training protocols increased glucose tolerance. Biomarkers of inflammation were also reduced by decreasing the expression of NLRP-3 and IL-18 (4). In this regard, moderate physical activity reduced the activity of NLRP-3, NLRP-1, and IL-1β and IL-18 levels in the hippocampus of mice and improved depressive behavior (5). Oxidative stress and neurodegenerative diseases have been reported to increase NLRP-1 activity, leading to neuroinflammation and axonal degeneration (6). Liang et al. (2010) examined the levels of physical activity in older adults that were perceptually normal. It has also been noted that they had less exercise history due to high accumulations of Aβ, Tao protein, and phosphorylated tau, and active subjects had lower Aβ accumulations and higher Aβ42 cerebrospinal fluid levels. Higher levels of cerebrospinal fluid Aβ42 indicate greater clearance from the brain (7).
Song et al. (2016) reported that exercise improves recovery from neurological disorders by modulating inflammatory biomarkers and inhibiting the NLRP complex (8). Wang et al. (2016) also showed that aerobic exercise reduced NLRP-3 in the rat hippocampus (5). It seems that the most important effect of physical activity is to reduce sediment and increase brain Aβ clearance. Brain mass protection may have functional benefits for AD patients who participate in regular exercise. Meng et al. (2020) showed that exercise has fewer side effects than drugs (9). Lin et al. (2015) reported that 10 weeks of treadmill training in transgenic mice increased memory and dendritic networks associated with hippocampal CA1 and CA3 neurons and decreased soluble Aβ levels in the hippocampus and amygdala. Exercise did not alter APP or RAGE levels but did increase LRP-1 levels in both areas of the brain (10). Wolf et al. (2006) showed that in transgenic mice under environmental enrichment, plaque Aβ, Morris water maze function improved, hippocampal neutrophils were upregulated, and hippocampal neurogenesis increased. However, transgenic mice did not show any change in the constant load of plaque Aβ, spatial learning, and hippocampal neurogenesis with running training, and in them, hippocampal growth factors and cerebral cortex were negatively regulated (11). Overall, the current study demonstrated that probiotic consumption for 12 weeks positively affects cognitive function and some metabolic statuses in AD patients (12). They found probiotics and selenium co-supplementation for 12 weeks to patients with AD improved cognitive function and some metabolic profiles (13).
Beneficial effects included decreased disease severity, improved mental health, metabolic parameters, mainly insulin sensitivity, dyslipidemia, inflammation, anti-oxidative capacity, and lower use of healthcare. Co-supplementation of vitamin D and probiotics generated greater health benefits than its comparators did. More studies in other diseases and various populations are needed to confirm these findings and to elucidate the optimal form, composition, and frequency of this co-supplementation (14).
Although several drugs have been proposed to treat AD, they have failed due to limited efficacy, side effects, and no significant change in AD course. Some studies have shown that octopamine, as a biogenetic amine, plays an important role in memory formation (15). The effects of octopamine include antioxidant, anti-inflammatory, and anti-cancer effects. Its possible effects appear to be partly due to the release of glutamate by monoamine neurons (16). Examination of the inflammasome system, especially NLRP3 and NLRP1, provides new information for therapeutic interventions aimed at controlling inflammation in this area. Therefore, this study aimed was to investigate the effects of interval training with octopamine extract on NLRP1 and NLRP3 in the brain tissue of Alzheimer's rats.
Materials and Methods
Synergistic effects of exercise and supplementation reduce the levels of inflamasomes complex index indices and can have a regulatory effect on improving cognitive and cognitive function and delaying dementia-related disorders.
Alzheimer's disease is the most common cause of dementia in the elderly and is characterized by atrophy of certain areas of the brain, reduced progressive perception, and loss of memory, and inability to perform daily tasks. The innate immune response plays an important role in post-Alzheimer's pathology. Inflammation systems are a key component of the innate immune response. Inflammasomes are a set of several proteins based on: NLPR-3 and NLRP-1 (NOD-, LRR- and pyrin domain-containing protein 3), responsible for activating caspase-1, injury, and autoimmune diseases (1). Studies show that NLRP-3 and NLRP-1 may play important roles in metabolic disorders, inflammatory responses, Alzheimer's, and ischemia (2). Physical activity can affect dementia and the perception and development of Alzheimer's disease (3) and mediate its anti-inflammatory effects by regulating the activity of inflammation. Mardar et al. (2016) showed that endurance training protocols increased glucose tolerance. Biomarkers of inflammation were also reduced by decreasing the expression of NLRP-3 and IL-18 (4). In this regard, moderate physical activity reduced the activity of NLRP-3, NLRP-1, and IL-1β and IL-18 levels in the hippocampus of mice and improved depressive behavior (5). Oxidative stress and neurodegenerative diseases have been reported to increase NLRP-1 activity, leading to neuroinflammation and axonal degeneration (6). Liang et al. (2010) examined the levels of physical activity in older adults that were perceptually normal. It has also been noted that they had less exercise history due to high accumulations of Aβ, Tao protein, and phosphorylated tau, and active subjects had lower Aβ accumulations and higher Aβ42 cerebrospinal fluid levels. Higher levels of cerebrospinal fluid Aβ42 indicate greater clearance from the brain (7).
Song et al. (2016) reported that exercise improves recovery from neurological disorders by modulating inflammatory biomarkers and inhibiting the NLRP complex (8). Wang et al. (2016) also showed that aerobic exercise reduced NLRP-3 in the rat hippocampus (5). It seems that the most important effect of physical activity is to reduce sediment and increase brain Aβ clearance. Brain mass protection may have functional benefits for AD patients who participate in regular exercise. Meng et al. (2020) showed that exercise has fewer side effects than drugs (9). Lin et al. (2015) reported that 10 weeks of treadmill training in transgenic mice increased memory and dendritic networks associated with hippocampal CA1 and CA3 neurons and decreased soluble Aβ levels in the hippocampus and amygdala. Exercise did not alter APP or RAGE levels but did increase LRP-1 levels in both areas of the brain (10). Wolf et al. (2006) showed that in transgenic mice under environmental enrichment, plaque Aβ, Morris water maze function improved, hippocampal neutrophils were upregulated, and hippocampal neurogenesis increased. However, transgenic mice did not show any change in the constant load of plaque Aβ, spatial learning, and hippocampal neurogenesis with running training, and in them, hippocampal growth factors and cerebral cortex were negatively regulated (11). Overall, the current study demonstrated that probiotic consumption for 12 weeks positively affects cognitive function and some metabolic statuses in AD patients (12). They found probiotics and selenium co-supplementation for 12 weeks to patients with AD improved cognitive function and some metabolic profiles (13).
Beneficial effects included decreased disease severity, improved mental health, metabolic parameters, mainly insulin sensitivity, dyslipidemia, inflammation, anti-oxidative capacity, and lower use of healthcare. Co-supplementation of vitamin D and probiotics generated greater health benefits than its comparators did. More studies in other diseases and various populations are needed to confirm these findings and to elucidate the optimal form, composition, and frequency of this co-supplementation (14).
Although several drugs have been proposed to treat AD, they have failed due to limited efficacy, side effects, and no significant change in AD course. Some studies have shown that octopamine, as a biogenetic amine, plays an important role in memory formation (15). The effects of octopamine include antioxidant, anti-inflammatory, and anti-cancer effects. Its possible effects appear to be partly due to the release of glutamate by monoamine neurons (16). Examination of the inflammasome system, especially NLRP3 and NLRP1, provides new information for therapeutic interventions aimed at controlling inflammation in this area. Therefore, this study aimed was to investigate the effects of interval training with octopamine extract on NLRP1 and NLRP3 in the brain tissue of Alzheimer's rats.
Materials and Methods
- Animals
The research was conducted experimentally with a post-test design. The statistical population of this study was male Wistar rats (220-250 g). Thirty male Wistar rats at the age of eight weeks were obtained from the Pasteur Institute. All stages of the research were carried out under the rules of ethics in research, under the supervision and obtaining a code of ethics from the Medical School of the Islamic Azad University ( IR.IAU.VARAMIN.REC.1399.042 ,1399/12/20). Rats were kept in the animal laboratory (12 hours of light and 12 hours of darkness), the temperature of 22±2 °C and humidity of about 45% and they had free access to standard water and food. Three to five rats were kept in Plexiglas cages with mesh doors measuring 25 by 27 by 43 cm so that they had free access to standard water and food (17, 18).
- Grouping
After three days of familiarity with the environment, the rats were introduced to the treadmill and how to run on it for 10 minutes, five times a week. After 48 hours of rest from the last familiarization session, the rats were tested for measurement of maximal exhaustion test and the maximum oxygen consumption was predicted (19). Rats were randomly divided into 5 groups (healthy control, Alzheimer sham, Alzheimer+ interval training, Alzheimer+ octopamine, interval training+ Alzheimer+ octopamine).
- Alzheimer induction
To prepare beta-amyloid peptide 1-42, we first dissolved beta-amyloid in DMSO buffer solution until its pH reached 7.4, and then the resulting solution was incubated at 37°C for three days to make the beta-amyloid dense. It was then stored at -70°C (20). After overnight rest, the animals were anesthetized by intraperitoneal injection of ketamine and xylazine. The heads of the animals were then fixed in the stereotaxic device and by creating a longitudinal incision in the posterior part of the skull, special injection cannulas were inserted into the lateral ventricles in the posterior position of 0.8 mm, 1.5 mm on both sides of the longitudinal incision and 2.5 mm below the surface of the skull. Beta-amyloid (one microliter on each side) was injected into the hippocampus with a Hamilton syringe. To ensure the correct injection site in the brain, the dye was injected into two heads of rats and the injection site was examined after euthanized. In the sham group, all laboratory steps were the same as in the beta-amyloid injection group, except that in the sham group, one microliter of DMSO buffer was injected into each of the hippocampi.
After the end of the study period, the rats were euthanized and the injection site was examined (21).
After the end of the study period, the rats were euthanized and the injection site was examined (21).
- Exercise protocol
The main exercise consisted of a combination of intense interval repetitions and active rest. Intense interval includes running, 80-110% maximum intensity in the first week-ten week (Table 1). Active rest includes two minutes of running, 40% maximum intensity from the first week to the end of the third week, and 30% maximum speed. The number of high-intensity interval repetitions is determined according to the training week of the mice. So that in the first week 2 repetitions, in the second week 4 repetitions and from the beginning of the third week onwards it included 6 repetitions (22). Rats were monitored in all training sessions and encouraged to continue running by manipulating with a sponge (23).
Table1. Exercise training protocol
| weeks | Time (min) | speed % |
| First week | 2 | 80 |
| Second week | 2 | 90 |
| Third week | 2 | 100 |
| Fourth week- ten week | 2 | 110 |
- Supplementation
Consumption of octopamine was injected as a supplement for 6 weeks, 5 days a week. Octapamine was a product of Sigma Aldrich Company, which was prepared in solution with 9% normal saline in a homogenase device. According to the instructions for use, rats were injected 81 micromoles per kilogram of body weight per 100 grams (24). The Morris water maze test was used to examine learning, which has adaptation stages and learning stages. And with the probe test, the spatial memory of the animals was evaluated. The explicit platform test was also used to evaluate the sensory-motor coordination and motivation of the animal (25).
- Laboratory Measurements of NLRP-1 and NLRP-3 expression
Three days after the last training session, rats were rapidly extracted by intraperitoneal injection of ketamine (90mg/kg) and xylazine (10 mg/kg). The hippocampus was frozen and refrigerated. Hippocampus was powdered by the mortar method and homogenized to extract total RNA. In order to remove the protein components of the product, the pellet containing RNA was washed. For each reaction, the kit instructions were used to prepare and add ingredients. In the beginning, the optimal cDNA concentration, as well as the primers related to each gene, was determined separately for each using a serial concentration test so that the lowest dimer and the best Ct were observed. Real time-PCR was performed (26) (Table 2).
Table 2. Sequence of primers
| Reverse primer 5´-3´ | Forward primer 5´-3´ | Gene |
| TGGACTGTCTGCCCATTGG TTGAATAGGCCAGGGTTTTG GGCCTCACTAAACCATCCAA |
AAGCTGAAAGTCAACAAATGACAGTT ACTTGCATTGCTGATTGCTG GCAATTATTCCCCATGAACG |
NLRP-1 NLRP-3 18S |
- Statistical analysis
Data analysis was collected and analyzed using SPSS and Excel software. Mean, Standard Deviation, graph drawing was used. Normality of data was assessed using the Shapiro-Wilks and using the Leven test, the homogeneity of variance was determined (P≤0.05).The one-way ANOVA and Bonferroni post hoc test were used to estimate inter-group differences after Alzheimer's induction (P ≤0.05).
Result
Result
- Response NLRP-1 to interval training and octopamine
Descriptive information was reviewed and recorded. Using the Leven test, the homogeneity of variances was investigated and confirmed. The results of the Shapiro-Wilks test also showed the normal distribution of data. The highest decrease in NLRP-1 mRNA was observed in the interval training + octopamine+ Alzheimer group. The largest increase is in the Alzheimer's group, followed by Alzheimer's and supplements. There was a significant difference in NLRP-1 mRNA levels between the groups. Bonferroni post hoc test was used to examine the details in more detail and to compare the groups with each other. The results of the Bonferroni post hoc test showed that there was no significant difference only between the control group and the Alzheimer's group + interval training + octopamine supplementation. But there is a significant difference between the control group and other groups (P≤0.05). There was a significant difference between Alzheimer's group and all groups except Alzheimer's + octopamine supplement (P≤0.05) (Figure 1).
Figure 1. Comparison of gene expression and significant changes NLPR-1 between five Groups of male rats
**: P ≤ 0.05, significant difference between control group and another group
##: P ≤ 0.05, significant difference between Alzheimer group and another group
**: P ≤ 0.05, significant difference between control group and another group
##: P ≤ 0.05, significant difference between Alzheimer group and another group
- Response NLRP-3 to interval training and octopamine
The greatest decrease in NLRP-3 mRNA was observed in the interval training group. The largest increase is in the Alzheimer's group. There was a significant difference in NLRP-3 mRNA levels between the groups. Bonferroni post hoc test was used to examine the details in more detail and to compare the groups with each other. The results showed there was no significant difference only between the control group and the Alzheimer's group+ interval training+ octopamine. But there is a significant difference between the control group and other groups (P≤0.05). There was a significant difference between Alzheimer's group and all groups except Alzheimer's + octopamine supplement (P≤0.05) (Figure 2).
Figure 2. Comparison of gene expression and significant changes NLPR-3between five Groups of male rats
**: P ≤ 0.05, significant difference between control group and another group
##: P ≤ 0.05, significant difference between Alzheimer group and another group
**: P ≤ 0.05, significant difference between control group and another group
##: P ≤ 0.05, significant difference between Alzheimer group and another group
Discussion
The results of the present study showed that there was a significant difference between the groups in the amount of NLRP-1 mRNA and NLRP-3 mRNA. Alzheimer's disease is associated with decreased cognitive function and the hippocampus appears to be more susceptible to aging and neurodegenerative diseases of the joints and synaptic plasticity (27). It has been suggested that interval training may be effective against inflammation and the factors involved in neurodegeneration. The effect of physical activity on improving brain function has been confirmed by ductile adaptations at the synaptic and mitochondrial levels (28). Thus, the interval training protocol has been implicated as a mediator in controlling cytokines, regulating receptor activity, and supporting the immune system. As a result, it has improved the cognitive status of Alzheimer's rats and the anti-inflammatory effects of exercise have been effective in regulating the activity of inflammation. Stranahan et al (2010) achieved these results using rodents and long periods of forced exercise on an ergometer (28). In line with the results of this study, Cotman et al (2002) showed that long-term moderate-intensity exercise programs are suitable for improving cognitive function (29). Also, Parachikova et al (2008) showed, after three weeks of running an optional ergometer in Tg2576 transgenic Alzheimer's mice, cognitive function improved unchanged at insoluble levels of Aβ1-40 and Aβ1-42. This condition may be caused by changes in the inflammatory response (30).
Of course, these studies had different training protocols. Mardar et al. (2016) showed that endurance training increased glucose tolerance and decreased biomarkers of inflammation and body weight. This decrease is due to the increased expression of NLRP-3 and IL-18 in adipose tissue (4). Wang (2016) et al showed that moderate-intensity physical activity protocol reduces the activity of NLRP-3 in the hippocampus of mice (5). Decreased NLRP-3 in the hippocampus of obese mice with endurance training and increased BDNF expression has also been reported (31). The results of Darvishzadeh et al. (2021) also showed a decrease in NLRP-3. Their samples were poisoned mice (32).
The contradiction between the results of this study and other studies is due to the intensity, duration of training. Increasing the training period, the number of training sessions, and the mechanism involved in the beneficial effects of periodic training affect the structure and function of the brain. Reduction of oxidative stress, NLRP-1, NLRP-3, and secretion of neurotrophins also affect the structure of the hippocampus (5, 6, 19, 33).
Regarding the role of octopamine, it can be said that this supplement led to a decrease in NLRP-1 and NLRP-3 in the exercise and supplement groups. Octopamine has antioxidant, metabolic, and fat-burning effects. It also has anti-cancer effects and an adrenergic role. Therefore, it has been able to control the effects of Alzheimer's and cognitive limitations to some extent. The role of NLRP-1 in the production of inflammatory factors, axonal degradation, and increasing the positive immune response of neurons to NLRP-1 in Alzheimer's brain is 25-35 times compared to non-Alzheimer's brain (6).
Octopamine is an adrenoceptor due to its close association with norepinephrine, its effect on adrenergic and dopaminergic systems, and its mimicry of sympathetic function. Therefore, in the present study, the use of octopamine in combination with periodic exercise has led to a further reduction of inflammatory factors (NLRP-1 and NLRP-3) compared to exercise groups and increased antioxidant activity in Alzheimer's mice (16).
Kazemi et al. (2015) reported that octopamine use combined with aerobic exercise reduced the complexity of inflammation and apoptosis and improved the regenerative capacity of heart cells in obese mice (25), the results of which are similar to the present study. In this regard, long-term forced exercise increases memory and learning, and at the same time, affects the number of nerve cells and inflammatory factors such as NLRP-1 and NLRP-3.
Of course, better cognitive performance is due to increased exercise. Exercise also facilitates the repair of brain damage, facilitates nutritional factors in differentiating progenitor cell survival, changes in the synaptic system, long-term strengthening, and better memory function. Therefore, exercise activity of synaptic organization has increased learning and neurogenesis, and octopamine supplementation has synergized cognitive improvement in Alzheimer's mice.
Conclusion
Alzheimer's drug therapies have limited efficacy and side effects and have failed to treat and prevent AD. Octopamine as a biogenetic combination of amines, adrenergic, and antioxidants is effective in the formation of memory and with interval training led to a significant reduction of the inflammatory system (NLRP3 and NLRP1) compared to Alzheimer's and non-exercise groups. Therefore, a healthy lifestyle combined with exercise and complementary foods can help fight Alzheimer's.
Acknowledge
Thanks to the officials and technicians of the laboratory who helped us in doing this research.
The results of the present study showed that there was a significant difference between the groups in the amount of NLRP-1 mRNA and NLRP-3 mRNA. Alzheimer's disease is associated with decreased cognitive function and the hippocampus appears to be more susceptible to aging and neurodegenerative diseases of the joints and synaptic plasticity (27). It has been suggested that interval training may be effective against inflammation and the factors involved in neurodegeneration. The effect of physical activity on improving brain function has been confirmed by ductile adaptations at the synaptic and mitochondrial levels (28). Thus, the interval training protocol has been implicated as a mediator in controlling cytokines, regulating receptor activity, and supporting the immune system. As a result, it has improved the cognitive status of Alzheimer's rats and the anti-inflammatory effects of exercise have been effective in regulating the activity of inflammation. Stranahan et al (2010) achieved these results using rodents and long periods of forced exercise on an ergometer (28). In line with the results of this study, Cotman et al (2002) showed that long-term moderate-intensity exercise programs are suitable for improving cognitive function (29). Also, Parachikova et al (2008) showed, after three weeks of running an optional ergometer in Tg2576 transgenic Alzheimer's mice, cognitive function improved unchanged at insoluble levels of Aβ1-40 and Aβ1-42. This condition may be caused by changes in the inflammatory response (30).
Of course, these studies had different training protocols. Mardar et al. (2016) showed that endurance training increased glucose tolerance and decreased biomarkers of inflammation and body weight. This decrease is due to the increased expression of NLRP-3 and IL-18 in adipose tissue (4). Wang (2016) et al showed that moderate-intensity physical activity protocol reduces the activity of NLRP-3 in the hippocampus of mice (5). Decreased NLRP-3 in the hippocampus of obese mice with endurance training and increased BDNF expression has also been reported (31). The results of Darvishzadeh et al. (2021) also showed a decrease in NLRP-3. Their samples were poisoned mice (32).
The contradiction between the results of this study and other studies is due to the intensity, duration of training. Increasing the training period, the number of training sessions, and the mechanism involved in the beneficial effects of periodic training affect the structure and function of the brain. Reduction of oxidative stress, NLRP-1, NLRP-3, and secretion of neurotrophins also affect the structure of the hippocampus (5, 6, 19, 33).
Regarding the role of octopamine, it can be said that this supplement led to a decrease in NLRP-1 and NLRP-3 in the exercise and supplement groups. Octopamine has antioxidant, metabolic, and fat-burning effects. It also has anti-cancer effects and an adrenergic role. Therefore, it has been able to control the effects of Alzheimer's and cognitive limitations to some extent. The role of NLRP-1 in the production of inflammatory factors, axonal degradation, and increasing the positive immune response of neurons to NLRP-1 in Alzheimer's brain is 25-35 times compared to non-Alzheimer's brain (6).
Octopamine is an adrenoceptor due to its close association with norepinephrine, its effect on adrenergic and dopaminergic systems, and its mimicry of sympathetic function. Therefore, in the present study, the use of octopamine in combination with periodic exercise has led to a further reduction of inflammatory factors (NLRP-1 and NLRP-3) compared to exercise groups and increased antioxidant activity in Alzheimer's mice (16).
Kazemi et al. (2015) reported that octopamine use combined with aerobic exercise reduced the complexity of inflammation and apoptosis and improved the regenerative capacity of heart cells in obese mice (25), the results of which are similar to the present study. In this regard, long-term forced exercise increases memory and learning, and at the same time, affects the number of nerve cells and inflammatory factors such as NLRP-1 and NLRP-3.
Of course, better cognitive performance is due to increased exercise. Exercise also facilitates the repair of brain damage, facilitates nutritional factors in differentiating progenitor cell survival, changes in the synaptic system, long-term strengthening, and better memory function. Therefore, exercise activity of synaptic organization has increased learning and neurogenesis, and octopamine supplementation has synergized cognitive improvement in Alzheimer's mice.
Conclusion
Alzheimer's drug therapies have limited efficacy and side effects and have failed to treat and prevent AD. Octopamine as a biogenetic combination of amines, adrenergic, and antioxidants is effective in the formation of memory and with interval training led to a significant reduction of the inflammatory system (NLRP3 and NLRP1) compared to Alzheimer's and non-exercise groups. Therefore, a healthy lifestyle combined with exercise and complementary foods can help fight Alzheimer's.
Acknowledge
Thanks to the officials and technicians of the laboratory who helped us in doing this research.
Type of Article: Original article |
Subject:
Basic Medical Sciences
Received: 2021/05/31 | Accepted: 2021/08/7 | Published: 2021/09/29
Received: 2021/05/31 | Accepted: 2021/08/7 | Published: 2021/09/29
References
1. De Rivero Vaccari JP, Lotocki G, Alonso OF, Bramlett HM, Dietrich WD, Keane RW. Therapeutic neutralization of the NLRP1 inflammasome reduces the innate immune response and improves histopathology after traumatic brain injury. Journal of Cerebral Blood Flow & Metabolism 2009; 29(7):1251-61. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
2. Cassel SL, Sutterwala FS. Sterile inflammatory responses mediated by the NLRP3 inflammasome. European journal of immunology 2010; 40(3):607-11. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
3. Rolland Y, Abellan van Kan G, Vellas B. Healthy brain aging: role of exercise and physical activity. Clinics in geriatric medicine 2010; 26(1):75-87. [view at publisher] [DOI] [PMID] [Google Scholar]
4. Mardare C, Krüger K, Liebisch G, Seimetz M, Couturier A, Ringseis R, et al. Endurance and resistance training affect high fat diet-induced increase of ceramides, inflammasome expression, and systemic inflammation in mice. J Diabetes Res 2016; 4536470. Published online 2015 Dec 14. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
5. Wang Y, Xu Y, Sheng H, Ni X, Lu J. Exercise amelioration of depression-like behavior in OVX mice is associated with suppression of NLRP3 inflammasome activation in hippocampus. Behavioral brain research 201; 307: 18-24. [view at publisher] [DOI] [PMID] [Google Scholar]
6. Kaushal V, Dye R, Pakavathkumar P, Foveau B, Flores J, Hyman B, et al. Neuronal NLRP1 inflammasome activation of Caspase-1 coordinately regulates inflammatory interleukin-1-beta production and axonal degeneration-associated Caspase-6 activation. Cell Death & Differentiation 2015; 22(10):1676-86. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
7. Liang KY, Mintun MA, Fagan AM, Goate AM, Bugg JM, Holtzman DM, et al. Exercise and Alzheimer's disease biomarkers in cognitively normal older adults. Annals of neurology 2010; 68(3):311-8. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
8. Song L, Pei L, Yao S, Wu Y, Shang Y. NLRP3 inflammasome in neurological diseases, from functions to therapies. Frontiers in cellular neuroscience. 2017 Mar 9;11:63. [view at publisher] [DOI] [Google Scholar]
9. Meng Q, Lin M, Tzeng IS. Relationship between Exercise and Alzheimer's disease: A Narrative Literature Review. Front Neurosci 2020; 14:131. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
10. Lin TW, Shih YH, Chen SJ, Lien CH, Chang CY, Huang TY, Chen SH, Jen CJ, Kuo YM. Running exercise delays neurodegeneration in amygdala and hippocampus of Alzheimer’s disease (APP/PS1) transgenic mice. Neurobiology of learning and memory 2015 ;118: 189-97. [view at publisher] [DOI] [PMID] [Google Scholar]
11. Wolf SA, Kronenberg G, Lehmann K, Blankenship A, Overall R, Staufenbiel M, Kempermann G. Cognitive and physical activity differently modulate disease progression in the amyloid precursor protein (APP)-23 model of Alzheimer’s disease. Biological psychiatry 2006 ; 60(12):1314-23. [view at publisher] [DOI] [PMID] [Google Scholar]
12. Akbari E, Asemi Z, Daneshvar Kakhaki R, Bahmani F, Kouchaki E, Tamtaji OR, et al. Effect of Probiotic Supplementation on Cognitive Function and Metabolic Status in Alzheimer's Disease: A Randomized, Double-Blind and Controlled Trial . Front Aging Neurosci 2016 ;10( 8): 256. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
13. Tamtaji OR, Heidari-Soureshjani R, Mirhosseini N, Kouchaki E, Bahmani F , Aghadavod E, et al. Probiotic and selenium co-supplementation, and the effects on clinical, metabolic and genetic status in Alzheimer's disease: A randomized, double-blind, controlled trial. Clin Nutr 2019 Dec; 38(6):2569-2575. [view at publisher] [DOI] [PMID] [Google Scholar]
14. Abboud M , Rizk R , AlAnouti F , Papandreou D , Haidar S , Mahboub N. The Health Effects of Vitamin D and Probiotic Co-Supplementation: A Systematic Review of Randomized Controlled Trials. Nutrients 2020 Dec 30; 13(1):111. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
15. Bostancıklıoğlu M. Optogenetic stimulation of serotonin nuclei retrieves the lost memory in Alzheimer's disease. Journal of cellular physiology 2020; 235(2):836-47. [view at publisher] [DOI] [PMID] [Google Scholar]
16. Sherer LM, Garrett EC, Morgan HR, Brewer ED, Sirrs LA, Shearin HK, et al. Octopamine neuron dependent aggression requires dVGLUT from dual-transmitting neurons. PLoS genetics 2020; 16(2):e1008609. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
17. Chin J. Selecting a mouse model of Alzheimer's disease. Methods Mol Biol 2011;670:169-189. [view at publisher] [DOI] [PMID] [Google Scholar]
18. Doost mohammad pour J, Hosseinmardi N, Janahmadi M, Ebrahimi S, Fathollahi Y, Motamedi F. Induction of a rat model of Alzheimer's disease by amyloid-β did not change short term synaptic plasticity in CA1 area of hippocampus. koomesh 2014; 16 (1) :76-81. [view at publisher] [Google Scholar]
19. Pennisi M, Crupi R, Di Paola R, Ontario ML, Bella R, Calabrese EJ, et al. Inflammasomes, hormesis, and antioxidants in neuroinflammation: role of NRLP3 in Alzheimer disease. Journal of neuroscience research 2017; 95(7):1360-72. [view at publisher] [DOI] [PMID] [Google Scholar]
20. Prakash A, Medhi B, Chopra K. Granulocyte colony stimulating factor (GCSF) improves memory and neurobehavior in an amyloid-β induced experimental model of Alzheimer's disease. Pharmacology Biochemistry and Behavior 2013;110: 46-57. [view at publisher] [DOI] [PMID] [Google Scholar]
21. Rubartelli A. DAMP-mediated activation of NLRP3-inflammasome in brain sterile inflammation: the fine line between healing and neuro-degeneration. Frontiers in immunology 2014; 5: 99. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
22. Aibara C, Okada N, Watanabe D, Shi J, Wada M. Effects of high-intensity interval exercise on muscle fatigue and SR function in rats: a comparison with moderate-intensity continuous exercise. J Appl Physiol 2020; 129(2):343-352. [view at publisher] [DOI] [PMID] [Google Scholar]
23. Vodie E, Barzegar H, Borjianfard M.Effect of Endurance and High-Intensity Interval Training (HIIT (on Brain-Derived Neurotrophic Factor (BDNF) in the Rat Hippocampus. journal of ilam university of medical sciences 2016;23(6):1-9. [view at publisher] [Google Scholar]
24. Dezhan M, Azarbayjani M A, peeri M. Effect of aerobic and octopamine supplementation on the expression of ACC and ACYL genes and HDL / LDL ratio in visceral visceral adipose tissue of DFO recipient. RJMS 2020; 27 (7):109-119 [view at publisher] [Google Scholar]
25. Kazemi Dareh Bidi M, Peeri M, Azarbayjani MA. The effect of endurance exercise training and octopamine supplement on NLRP1 inflammasome PI3K apoptosis and histopathological changes in heart tissue of rats poisoned with deep fried oil. Studies in Medical Sciences 2020; 31(9):667-679. [view at publisher] [DOI] [Google Scholar]
26. Do Carmo S, Cuello C. Modeling Alzheimer's disease in transgenic rats. Do Carmo and Cuello Molecular Neurodegeneration 2013; 8(37):2-11. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
27. Burger C. Region-specific genetic alterations in the aging hippocampus: implications for cognitive aging. Front Aging Neurosci 14 October 2010. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
28. Stranahan AM, Lee K, Becker KG, Zhang Y, Maudsley S, Martin B, et al. Hippocampal gene expression patterns underlying the enhancement of memory by running in aged mice. Neurobiology of aging 2010; 31(11):1937-49. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
29. Cotman CW, Berchtold NC. Exercise: a behavioral intervention to enhance brain health and plasticity. Trends in neurosciences 2002; 25(6):295-301. [view at publisher] [DOI] [Google Scholar]
30. Parachikova A, Nichol KE, Cotman CW. Short-term exercise in aged Tg2576 mice alters neuroinflammation and improves cognition. Neurobiology of disease 2008; 30(1):121-9. [view at publisher] [DOI] [PMID] [PMCID] [Google Scholar]
31. Cai M, Wang H, Li J-j, Zhang Y-L, Xin L, Li F, et al. The signaling mechanisms of hippocampal endoplasmic reticulum stress affecting neuronal plasticity-related protein levels in high fat diet-induced obese rats and the regulation of aerobic exercise. Brain behavior and immunity 2016;57: 347- 59. [view at publisher] [DOI] [PMID] [Google Scholar]
32. Darvishzadeh N, Azizbeigi K, Etemad Z. The Effect of Aerobic Exercises and Octopamine Consumption on Changes in Gene Expression of Caspase-9, Nlrp3, Aim2 in Brown Adipose Tissue of Rats after Intoxication with Deep Fried Oil: An Experimental Study. J Rafsanjan Univ Med Sci 2021; 20 (1): 37-52. [view at publisher] [DOI] [Google Scholar]
33. Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of pro-IL-β. Molecular cell 2002; 10(2):417-26. [view at publisher] [DOI] [Google Scholar]
Send email to the article author
| Rights and permissions | |
 |
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License. |
